• 30 janvier 2023 23:12

Les preuves biochimiques et statistiques officielles confirment à 100% que Moderna a créé le Covid-19

Juil 8, 2022

Voici la présentation de l’étude que les preuves biochimiques et statistiques officielles confirment à 100% que Moderna a créé le Covid-19.

En préambule, on notera le revirement de position sur l’origine du virus. M. Jeffrey Sachs conçoit que le virus pourrait émaner des laboratoires américains.

J’ai mis aussi l’étude du Pr Montagnier, car on y fait référence dans cette nouvelle étude concernant Moderna.

Cette nouvelle étude montre les liens avec des brevets de la société Moderna.

Vous trouverez après cette page de présentation des extraits concernant Mr Sachs, le Pr Montagnier et le « Lecteur » qui a rédigé cette étude.

J’ai un peu expurgé l’étude pour rendre lisible mais c’est un peu long.

Pour les experts et chercheurs, ils peuvent étudier directement en ligne l’étude complète où les liens sont actifs sauf ceux donnant accès aux études de Pr Montagnier. J’ai remis des nouveaux liens dans le corps de l’article pour l’étude du Pr Montagnier. Les conclusions de l’étude du Pr Montagnier se retrouvent en fin d’article.

L’auteur de l’étude a une présentation de son travail scientifique qui est parfois très personnelle. À la fin de l’article il lance un défi :

« Veuillez donc me montrer un virus naturel (de préférence un virus apparu avant l’apparition de Moderna) avec un site de clivage de la furine contenant deux codons CGG et vous vaincrez mon argument. »

Bonne lecture,


Alain Sebilleau

• fil d’articles dédié au Covid-19 et les « vaccins » https://twitter.com/alainsebil
Rappel : Livre ou e-book gratuit en ligne. 400p/1300 références expliquant tous les aspects et allant même jusqu’a l’implication de Big Pharma et des  financiers derriere big Pharma. Plandémie Covid-191.

Récente prise de position de Jeffrey Sachs qui préside la commission Covid-19 de la revue médicale The Lancet

À noter : d’après Jeffrey Sachs le président de la commission Covid du fameux The Lancet : on admet maintenant une bévue de la biotechnologie des laboratoires américains, et il y a « suffisamment de preuves » qui vont dans ce sens.

Les dénégations générales des NIH ne sont plus suffisantes. Bien que le NIH et l’USAID aient vigoureusement résisté à la divulgation complète des détails du programme de travail EHA-WIV-UNC, plusieurs documents divulgués au public ou publiés par le biais de la Freedom of Information Act (FOIA) ont soulevé des préoccupations. Ces propositions de recherche indiquent clairement que la collaboration EHA-WIV-UNC a participé à la collecte d’un grand nombre de virus semblables au SRAS jusqu’à présent non documentés et s’est engagée dans leur manipulation dans les installations de laboratoire de niveau de sécurité biologique (BSL)-2 et BSL-3, ce qui soulève des préoccupations quant au fait qu’un virus en suspension dans l’air pourrait avoir infecté un travailleur de laboratoire. Divers scénarios ont été discutés par d’autres, y compris une infection impliquant un virus naturel recueilli sur le terrain ou peut-être un virus modifié manipulé dans l’un des laboratoires…2,3

Rappel de l’etude du Pr Montagnier

« Covid-19, SARS and bats coronaviruses genomes peculiar homologous RNA sequences »

Le Pr Montagnier présume que tout converge vers des manipulations de laboratoire avec un double objectif de conception de vaccins et virus a gain fonction.

Extraits de la conclusion :

… À travers les 14 faits relatifs à chacun des 14 paragraphes de cet article, tout converge vers de possibles manipulations de laboratoire (note de fin ci-dessous) qui ont contribué à modifier le génome du COVID-19, mais aussi, très probablement du SRAS beaucoup plus ancien, avec peut-être ce double objectif de conception de vaccins et de « gain de fonction » en termes de pénétration de ce virus dans la cellule…

… Cette analyse, réalisée in silico, est dédiée aux véritables auteurs du Coronavirus COVID-19. Il ne tient qu’à eux de décrire leurs propres expériences et pourquoi elles se sont transformées en un désastre mondial : 650 000 vies (le 26 juillet 2020), soit plus que celles prises par les deux bombes atomiques d’Hiroshima et de Nagasaki. Nous, les survivants, devrions tirer les leçons de cette grave alerte pour l’avenir de l’humanité. Nous demandons instamment à nos collègues scientifiques et médecins de respecter les règles éthiques telles qu’exprimées par le serment d’Hippocrate : ne pas nuire, jamais et jamais !…

Conclusions en bas de page4,5.

« Les preuves biochimiques et statistiques officielles confirment à 100% que Moderna a créé le Covid-19 »

Ceci est la nouvelle étude en lien avec les brevets spécifiques de Moderna.

Il est impossible de résumer, je vous engage à lire le condense ci-dessous. Plus expert à lire page de source avec tous les liens et différents brevets.

Tous les chercheurs et experts sont invités à venir vérifier cette étude. Il faut aller à la source pour avoir tous les liens actifs Je vous donne juste quelques éléments de la conclusion :

… Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit avant…

… Pourtant, six ans, après que Moderna l’ait breveté, nous le trouvons dans le Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc la probabilité que Moderna soit responsable plutôt que la nature n’est pas de 100 000 contre 6 ou de 16 666 contre 1. Non, elle est de 100% parce que la nature ne l’a pas fait. Elle ne l’a jamais fait et il n’y a aucune preuve qu’elle le fera un jour…

… Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existent nulle part dans la nature. Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA…

… C‘est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature…


Les preuves biochimiques et statistiques officielles confirment à 100% que Moderna a créé le Covid-19

par The Expose.

Des preuves ont émergé qui prouvent au-delà de tout doute raisonnable que le géant pharmaceutique Moderna, la société qui a gagné des milliards grâce à la vente d’une injection expérimentale de Covid-19, a en fait créé le virus Covid-19.

Le 23 février, le Daily Mail a publié un article montrant que Moderna avait breveté la séquence de 19 lettres de base (nucléotides) qui code pour le site Furin Cleavage dans Covid-19.

Extraits :

Par un lecteur inquiet

Ils ont cité un article rédigé par des scientifiques en Inde, en Suisse, en Italie et aux États-Unis (avec prudence intitulé : « MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site ») dans lequel ils ont calculé que les chances d’une séquence de 19 nucléotides brevetée par Moderna apparaissant au hasard dans Covid-19 dans des circonstances où il n’apparaît nulle part ailleurs dans la nature sont de 1 sur 3 billions6.

Mais ils n’ont pas réussi à en tirer la déduction évidente. S’ils avaient fait cette déduction évidente, je crains que cela n’ait été la dernière déduction scientifique qu’ils aient jamais publiée !

Ils ont décidé d’enquêter sur la séquence d’ARN du site de clivage de la furine dans la protéine de pointe Covid-19 pour voir si cela se produisait ailleurs dans la nature.

Heureusement, le NCBI/NIH a produit la merveilleuse base de données BLAST qui répertorie toutes les séquences de gènes dans la nature connue de l’homme et toutes les séquences de gènes synthétiques brevetées connues de l’office des brevets.

Les chercheurs ont choisi la séquence Furin Cleavage car il s’agit de la seule séquence continue de lettres de gène (séquence de nucléotides) dans Covid-19 avec plus de 3 nucléotides, qui différaient des lettres respectives dans son parent naturel le plus proche, le Bat Coronavirus RaTG13 (toutes les autres différences sont 3 lettres ou moins). C’était donc de loin le meilleur candidat pour déterminer si le Covid-19 était ou non créé par l’homme.

Le lecteur pourrait considérer qu’il est plus probable qu’un site de clivage Furin apparaisse dans le Sun que dans le Daily Mail. Mais ce clivage fait référence à la séparation du pic du virus plutôt que de l’oreiller de l’oreiller.

De plus, le site de clivage de la furine est la clé de la pathogénicité de Covid-19. Donc, s’il devait y avoir un gain de fonction créé par l’homme inclus dans le virus, c’est là que l’on pourrait s’attendre à le trouver.

La séquence d’acides aminés du site de clivage de la furine est PRRA (Proline Argenine Argenine Alanine). Chaque acide aminé est codé par un codon composé de 3 nucléotides (lettres de séquence génétique). Ainsi, toutes les différences dans le code génétique entre Covid-19 et RaTG13 sont au plus long d’un codon, d’un acide aminé, autre que la séquence de clivage de la furine, qui est…


La séquence complémentaire (le brin d’ADN associé de la double hélice est (GGAGCCGCCCGT) car C se lie à G et A se lie à T

Le compliment inverse (la même chose écrite à l’envers) est donc TGCCCGCCGAGG

Les chercheurs ont effectué une recherche d’alignement BLAST (Basic Local Alignment Search Tool) (ce qui signifie qu’ils recherchent la séquence du gène, la séquence du gène inverse, la séquence du gène complémentaire et la séquence du gène complémentaire inverse) à travers séquence de gènes dans la nature connue de l’homme depuis CTCCTCGGCGGGCACGTAG qui est la séquence de 19 nucléotides contenant la séquence de clivage de la furine, qui apparaît également dans Covid-19, et qui se trouve en fait sous la forme de complément inverse CTACGTGCCCCGCCGAGGAG brevetée par Moderna.

Leurs résultats de recherche peuvent être trouvés ici.

Le tableau 1 montre qu’il existe bien dans les 5 brevets américains cités ci-dessous…

US9149506B2 : Polynucléotides modifiés codant pour la septine-47

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc

2012-04-02 Priorité à US201261618953P
2013-12 -16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141067A1
2015-10-06 Publication de US9149506B2
2015-10-06 Demande accordée
2020-01-10 Premier litige familial mondial déposé

US9216205B2 : Polynucléotides modifiés codant pour la granulysine8

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc

2012-04-02 Priorité à US201261618873P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-04-24 Publication de US20140113960A1 2015-12-22
Publication de US9216205B2 2015-12-22
Demande accordant la

SIAH encodant polynucléotide E3subitine modifiée protéine ligase 19

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Cessionnaire actuel : ModernaTx Inc

2012-04-02 Priorité à US201261618868P
2013-12-16 Demande déposée par Moderna Therapeutics Inc
2014-05-22 Publication de US20140141068A1
2016-02-09 Demande accordée
2016-02-09 Publication de US9255129B2

US9301993B2 : Modified polynucleotides coding apoptosis inducing factor 110

Inventeur : Tirtha Chakraborty, Antonin de Fougerolles
Mandataire actuel : ModernaTx Inc

2012-04- 02 Priorité à US201261618957P
2013-12- 16 Demande déposée par Moderna Therapeutics Inc
2014-04-17 Publication de US20140107189A1
2016-04-05 Demande accordée
2016-04-05 Publication de US9301993B2
2020-01-10 Premier litige familial mondial déposé

US9587003B2 : Polynucléotides modifiés pour la production de protéines et de peptides liés à l’oncologie11

Inventeur : Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild

Cessionnaire actuel : ModernaTx Inc

2012-04-02 Priorité à US201261618868P
2016-02-04 Demande déposée par ModernaTx Inc
2016-06-02 Publication de US20160152678A1
2017-03-07 Publication de US9587003B2
2017-03-07 Demande accordée

… Ainsi, Moderna a déposé une première demande de brevet pour la séquence de 19 nucléotides en 2013 le 16 décembre. Peut-être que le 25 décembre aurait été plus approprié puisqu’il était destiné à devenir la couronne d’épines de Mathew27, Mark15 et John19.

Tableau 2 : montre que la séquence se produit dans Covid-19 du nucléotide 23601 à 23619.

Tableau 3 : montre que cette séquence de gène n’existe pas dans la nature (mais 14 parties nucléotidiques de celle-ci existent).

accès pour verification en ligne : https://expose-news.com/2022/07/04/proof-moderna-created-covid

J’ai décidé de vérifier leur travail. Oui. Je les ai effectivement vérifiés (j’enverrai une facture aux mondialistes). Cela s’est avéré être un voyage un peu épique. La page de brevet Google pour US9587003B2 ne contient pas la séquence du gène. Le pdf du brevet ne contient pas la séquence du gène et n’est pas consultable à partir des pages 101-304. Mais il a un lien vers une longue section « Liste des séquences » que l’on ne peut pas copier. Je l’ai donc transcrit manuellement de ma main juste12.

images explications verifications sur le site : https://expose-news.com/2022/07/04/proof-moderna-created-covid

Je peux donc confirmer, et le lecteur peut confirmer en utilisant les liens ci-dessus, que Moderna a demandé un brevet non seulement sur le complément inverse du site de clivage de la furine à 12 nucléotides dans Covid-19, mais en fait sur la séquence de 19 nucléotides le contenant comme décrit au dessus.

De plus, ils n’ont pas simplement déposé une demande de brevet le 4 février 2016 avec US9587003B2 : comme le rapporte le Daily Mail. Ils ont également été effectivement déposés le 16 décembre 2013 pour 4 brevets avec US9149506B2, US9216205B2, US9255129B2, US9301993B2.

Ainsi, Moderna avait développé la séquence de gènes de 19 nucléotides contenant le site de clivage de la furine qui donne à Covid-19 son infectivité pour l’homme grâce à une recherche brevetée sur le gain de fonction dès 2013, 6 ans avant l’épidémie de Wuhan. Pas 3 comme rapporté dans le Mail et viralement ailleurs..

Alors, maintenant, nous examinons les chances que cela se produise naturellement. L’article calcule la probabilité que cette séquence particulière de 19 nucléotides se produise de manière aléatoire dans un virus de 30 000 nucléotides comme

(30 000 – 18) × (1/4) 19 = 1,09 × 10 – 7

Ce qui est correct car il ya 30 000 à 18 places pour commencer la séquence étant donné qu’il faut encore 18 lettres supplémentaires pour la compléter. Mais il y a en fait 29 904 nucléotides dans Wuhan HU1 (alpha). Un calcul plus précis serait donc

(29 904 – 18) × (1/4) 19   = 1,087 × 10 – 7

Ensuite, ils calculent les chances que la séquence de 19 nucléotides se produise dans la bibliothèque brevetée de 24 712 séquences d’une longueur moyenne de 3300 nucléotides. Mais ce calcul n’est pas pertinent car la séquence n’est pas apparue au hasard dans 5 demandes de brevet Moderna. La séquence était connue pour coder pour un site de clivage de la furine, qui est connue pour fournir un gain de fonction aux coronavirus.

Il ya été mis délibérément et breveté en raison de son pouvoir infectieux chez l’homme, que nous verrons plus loin dans l’article, résultats du remplacement du codon viral normal de l’arginine (R) AGA (utilisé dans 45% des codons viraux de l’arginine) par le codon de l’arginine humaine CGG (utilisé dans 0% des codons de l’arginine virale) dans le site de clivage de la furine.

Tout ce que nous essayons de déterminer ici, c’est quelles sont les chances qu’une séquence de 19 nucléotides brevetée par Moderna apparaisse dans Covid-19 par des causes naturelles, les mutations naturelles du Bat Coronavirus RaTG13 ou d’un autre virus.

Les nucléotides forment des codons qui sont des triplets. Il y a donc 64 triplets possibles des 4 nucléotides d’ADN ACGT (4x4x4 = 64). Mais tous les triplés se produisent. 61 codent pour 20 acides aminés de manière redondante et 3 sont des codons stop qui indiquent au ribosome d’arrêter de fabriquer la protéine.

Mais les choses ne sont pas aussi simples car le site de clivage Furin apparaît dans la protéine de pointe là où il doit être et la protéine de pointe n’a que 1273 × 3 = 3819 nucléotides. Les chances que la séquence de 19 nucléotides Furin Cleavage apparaissent dans la protéine de pointe sont

(3 819 – 18) × (1/4) 19   = 1389 × 10 – 8

Soit 1 sur 72 millions. Ce serait donc les chances qu’une variante particulière, disons la première variante de Covid-19, ait la séquence de 19 nucléotides au bon endroit (le pic). Et il l’a fait. Donc, certainement selon la prépondérance des probabilités, et certainement au-delà de tout doute raisonnable (1 sur 72 millions étant un doute déraisonnable), Moderna a créé Covid-19.

Preuve 100% biochimique que Covid19 a été créé par l’homme

Le double codon CGG utilisé dans le site de clivage spécifique de la furine Moderna ne se produit dans aucun autre site de clivage de la furine dans aucun autre virus dans la nature. Les sites de clivage de la furine se produisent dans d’autres virus mais PAS du tout dans d’autres bétacoronavirus comme Covid-19 et PAS du tout avec le double codon CGG.

L’arginine (R), peut être codée par l’un des 6 triplets : AGG, AGA, CGA, CGC, CGG, CGT. Dans le Covid-19, le site de la furine (PRRA), compte 12 nucléotides (3 x 4). Dans le Covid-19, le doublet RR du site de la furine est codé par CGG-CGG.

Deux biochimistes, le professeur Antonio R. Romeu et le professeur assistant Enric Ollé, ont analysé le doublet RR à partir d’un large échantillon de sites de clivage de la furine de plusieurs types de virus. Ils ont découvert qu’il n’y avait aucun doublet RR codé par les codons CGG-CGG dans aucun virus dans la nature. Ils ont observé que le triplet AGA était le codon majoritaire impliqué dans ces doublets RR viraux.

Dans toute recombinaison génétique (où une partie d’un génome fusionne avec un autre génome), le code donneur est transmis à l’accepteur. Mais il n’y a tout simplement AUCUN VIRUS CONNU avec un site de clivage de la furine spécifique de Moderna (ayant la paire de codons CGG-CGG) qui existe pour donner un site de clivage de la furine spécifique de Moderna à Covid-19. Donc, la seule façon dont cette séquence pourrait entrer dans Covid-19 est de Moderna. Moderna était le donateur. La nature ne l’était pas. CQFD. Affaire classée..

Mais ça empire.

Les professeurs espagnols ont décidé d’analyser l’utilisation du codon de l’arginine dans chaque protéine de Covid-19. Le constat suivant…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%).

Ainsi, le triplet de codons AGA était majoritaire et, fait intéressant, CGG était le codon minoritaire de l’arginine dans le virus.

Mais c’est encore pire.

Dans le cas particulier de la protéine S, sur les 42 Arginines (R) dont elle dispose, 20 sont codées par AGA, et seulement 2 par CGG. Ces 2 bien sûrs, sont les deux dans le site de clivage Moderna Specific Furin.

Ainsi, la seule arginine dans la protéine de pointe qui est codée à la Moderna se trouve sur le site Furin Cleavage. Les 40 autres instances n’utilisent pas du tout CGG.

Ils continuent ensuite en commentant que chaque espèce individuelle dans la nature a ses propres préférences de codons. De toute évidence, les virus aiment AGA, et n’aiment pas du tout CGG, dans la nature.

Mais devinez quelle espèce utilise CGG pour l’arginine plus que les 5 autres codons concurrents – oui, son vieil homo sapiens. Nos préférences de codage pour l’arginine sont

AGG (20%)
AGA (20%)
CGA (11%)
CGC (19%)
CGG (21%)
CGT (9%).

Ainsi, le codon CGG dans le site de clivage de la furine sera issu de la recherche sur le gain de fonction chimérique (combinaison homme-animal).

Quelqu’un d’autre que Moderna aurait-il pu créer le Covid-19 en utilisant le site de clivage de la furine spécifique de Moderna ?

« De nouveaux documents montrent que 18 mois seulement avant l’apparition des premiers cas de Covid-19, les chercheurs avaient soumis des plans pour libérer des nanoparticules et des aérosols pénétrant dans la peau contenant de « nouvelles protéines de pointe chimériques » de coronavirus de chauve-souris dans des chauves-souris des cavernes du Yunnan, en Chine. Ils prévoyaient également de créer des virus chimériques, génétiquement améliorés pour infecter plus facilement les humains, et ont demandé 14 millions de dollars à la Defense Advanced Research Projects Agency (Darpa) pour financer les travaux.

Des articles, confirmés comme authentiques par un ancien membre de l’administration Trump, montrent qu’ils espéraient introduire des « sites de clivage spécifiques à l’homme » pour les coronavirus de chauve-souris, ce qui faciliterait l’entrée du virus dans les cellules humaines.

Lorsque Covid-19 a été séquencé génétiquement pour la première fois, les scientifiques étaient perplexes quant à la façon dont le virus avait développé une telle adaptation spécifique à l’homme au site de clivage de la protéine de pointe, raison pour laquelle il est si infectieux13.

Je peux voir tous les grands journalistes du Daily Mail et du Telegraph (sans parler des scientifiques du monde entier) faire toutes ces recherches sur Covid-19 et arriver à la conclusion logique inévitable qu’il y a eu un laboratoire accidentel ou délibéré fuite et doivent ensuite formuler leurs conclusions de manière à étiqueter cette forte probabilité comme une possibilité faible. 

Mais ci-dessus, nous l’avons prouvé comme un fait (puisque le codon CGG de la séquence de clivage spécifique de la furine de Moderna n’apparaît dans aucun site de clivage de la furine dans aucun virus naturel et, par conséquent, il ne peut pas avoir été le résultat d’une recombinaison génétique naturelle. Il doit donc être le résultat d’une insertion génétique faite par l’homme.

En théorie, une autre partie impliquée avec le NAIAD ou le NIH aurait pu utiliser le site de clivage de la furine breveté par Moderna et fabriquer Covid-19 eux-mêmes. Cela n’aurait brisé aucun brevet de Moderna. Le site de clivage Furin lui-même n’est pas brevetable étant connu depuis au moins 2004.

US7223390B2 : Insertion de sites de clivage de la furine protéase dans les protéines membranaires et leurs utilisations.

Bien que Moderna ait en fait pu breveter le codage Moderna Specific (CGG pour AGA) du site de clivage de la furine qui n’est pas connu dans la nature même aujourd’hui (si nous acceptons que Covid-19 soit créé par l’ homme).

Mais étant donné que la fuite de laboratoire (délibérée ou accidentelle) est venue de Wuhan, et compte tenu de la dissimulation chinoise et des démentis de Fauci exposés par le sénateur Rand Paul, et étant donné les dissimulations du NIH, du NIAID et des services de renseignements américains, quand leur Un rapport de 3 mois sur l’origine de Covid-19 commandé par l’imitateur présidentiel Biden n’a rien donné, et compte tenu des relations entre le NIAID, le NIH, le WIV, l’EcoHealth Alliance, l’Université de Caroline du Nord et Moderna, je ne vois aucune pièce pour quelqu’un d’autre.

De plus, toute la cabale impie des mauvais acteurs a commencé à développer le vaccin Moderna avant que la pandémie ne frappe14.

Mais les choses ne sont pas aussi simples que cela parce que la nature a certainement eu 100 000 ans pour fabriquer des virus humains et elle n’a jamais mis une seule fois un site de clivage de furine spécifique à Moderna (CGG pour AGA) dans quoi que ce soit, ni mis la séquence de 19 nucléotides dans quoi que ce soit avant.

Pourtant, six ans après que Moderna l’ait breveté, nous le trouvons dans Covid-19 dans des circonstances où Moderna travaille avec ce virus. Donc la probabilité que Moderna soit responsable plutôt que la nature n’est pas de 100 000 contre 6 ou de 16 666 contre 1. Non, elle est de 100% parce que la nature ne l’a pas fait. Elle ne l’a jamais fait et il n’y a aucune preuve qu’elle le fera un jour.

C’est l’homme qui mélange les codons humains et viraux de l’arginine, pas la nature. 

Le Pr Luc Montagnier a passé les dernières années de sa vie à prouver que le COVID-19 était créé par l’homme et qu’il contenait une grande partie du code génétique du VIH1.

Le professeur Luc Montagnier, avant de mourir le 8 février 2022, a fait un assassinat total du concept selon lequel Covid-19 a évolué naturellement en montrant qu’il avait une équivalence massive au VIH. Le diagramme ci-dessous montre une région de 275 nucléotides de Covid-19 qui contient 200 nucléotides du VIH/SIV (Simian ImmunoVirus). Et rappelez-vous qu’il y a 61 codons spécifiant 20 acides aminés. On peut donc dire la même chose en moyenne de 3 manières différentes avec des codons.

Vous pouvez télécharger un pdf de son étude ici  et les documents supplémentaires ici. C’est très technique. Mais il a récupéré le prix Nobel pour avoir découvert le virus VIH. Donc, si quelqu’un savait que le Covid avait été boosté par le VIH, ce serait lui. Il a souligné que le Covid-19 avait été créé par l’homme au début de la pandémie et qu’il avait lui-même été assassiné par la presse et les vérificateurs des faits en conséquence. Chaque contrôleur de faits qui l’a attaqué avait tort.

Aucune de leurs vérifications des faits n’avait de fondement scientifique. Ces tenues ne sont pas du tout des vérificateurs de faits bien sûr. Ce sont des agences de désinformation mondialistes, des fils de Goebbels, des fact chuckers et des négateurs de la science. Ils sont à peu près aussi dignes de confiance qu’une élection américaine. Je peux vérifier un fait par moi-même merci beaucoup. Je n’ai pas besoin qu’un étudiant de madrassa ayant subi un lavage de cerveau me dise son opinion sur un sujet qu’il n’a jamais étudié à l’université.

NdT : j’ai rajoute le lien de l’étude qui était invalide dans le texte. Extrait de l’étude en fin d’article.

Puisque nous avons prouvé au-delà de tout doute raisonnable (au-delà d’un doute sur 1 sur 72 millions de manière statique et avec 100% de certitude biochimique à partir du site de clivage de la furine spécifique de Moderna) que Moderna a fabriqué Covid-19. Et puisque Moderna et Fauci n’ont pas admis l’avoir fait et ont en fait dissimulé des preuves à cet effet, il se peut qu’ils cachent également autre chose.

Parce que les deux seules théories qui restent sont la théorie de la fuite accidentelle et la théorie de la fuite délibérée. Je veux dire que la grande majorité des fuites politiques ne sont pas des accidents. Ce sont des stratégies délibérées pour procurer un avantage au divulgateur ou à son commanditaire. Il est bien connu dans l’industrie informatique que les virus apparaissent quand les ventes d’antivirus sont nécessaires. Pourquoi les choses seraient-elles différentes avec les virus humains, maintenant qu’ils peuvent aussi être fabriqués par l’homme ? Surtout si l’on considère le rôle considérable joué par Bill Gates et sa fondation, ainsi que par GAVI et GVAP, dans le marché mondial de la vaccination.

La seule raison pour laquelle Moderna fabriquerait Covid-19 est de le libérer. Sinon, l’exercice entier serait financièrement futile, commercialement inutile.

La raison invoquée par Fauci pour faire de la recherche sur le gain de fonction est que l’homme a besoin d’être en avance sur la nature ou mauvais agents afin d’avoir un vaccin à temps si une maladie mute ou est génétiquement modifiée par les Chinois ou les Russes pour être mortelle.

Mais pour croire cela, il faut croire que Moderna est intéressé par le fait de sauver la vie des gens. Je suis désolé. Toutes leurs actions me montrent qu’ils sont intéressés par la vaccination des gens tout en sachant qu’elle est susceptible de leur coûter la vie.

Ils sont intéressés par le profit, le profit qui vient d’une pandémie. Ils ne sont pas les sauveurs de l’humanité qu’ils représentent. Ils sont nos exploiteurs et nos agresseurs.

Ils ont produit le virus afin de le propager, afin de se faire passer pour nos sauveurs de leur propre propagation. Ce ne sont pas les activités d’une figure de sauveur. Luc Montagnier essayait de nous sauver d’eux et il a été assassiné (professionnellement) par leurs groupies. Moderna effectuait des recherches sur le gain de fonction afin de libérer le virus et de forcer la création d’un vaccin contre celui-ci de manière à maximiser leurs profits. Ce n’est pas une théorie de la conspiration. C’est ce qui s’est passé précisément. Le prix de leurs actions a été multiplié par 20.

Ils l’ont libéré afin de vendre leurs vaccins et de détruire le système immunitaire de leurs clients parce que nos systèmes immunitaires réduisent leurs profits. C’est le business de Big Pharma.

La raison pour laquelle l’auteur est si sûr que Moderna ou ses agents ont fabriqué et divulgué le Covid-19 et la raison pour laquelle j’ai dit que c’était le cas au début de la pandémie, ce qui m’a valu autant de ridicule que le professeur Montagnier (que Dieu le bénisse), c’est que les Écritures disent dans Matthieu 27, Marc 15 et Jean 19 que…

29 Et ils (les soldats du gouverneur du verset 27) placèrent une couronne d’épines et la mirent sur sa tête, et un roseau dans sa main droite ; et ils s’agenouillèrent devant lui, et se moquèrent de lui, disant : Salut, roi des Juifs !

30 Et ils crachèrent contre lui, prirent le roseau et le frappèrent sur la tête. (Matthieu 27 ASV)

(NdT suit une analyse théologique)

Puis-je donc demander votre indulgence pendant que j’interprète ces mots :

Le département américain de la Défense a financé l’épissage génétique du coronavirus des protéines de pointe (Covid-19) par l’intermédiaire du NIH et du NIAID et de la DARPA qui ont d’abord infecté Jésus, par l’intermédiaire de son fiancé, les saints de la Nouvelle Alliance, juste après qu’il soit devenu le roi séculier, César à ces saints, les Juifs antitypiques, ceux qui se sont engagés à être des fils angéliques de Jacob, les nés de nouveau angéliquement.

Nous avons calculé que la malédiction qui a empêché Jésus de devenir César des saints s’est terminée en 2019Tishri15 (17/18 octobre). Glenn Beck a réalisé un documentaire montrant que 10 hôpitaux de Wuhan ont pris en charge des cas présentant des symptômes de Covid-19 en octobre 2019. Oui les gens. Le Covid-19 est une preuve que Jésus est désormais le Roi séculier sur les saints, les Juifs antitypiques, les Juifs par l’alliance angélique du salut, au moins.

Mais ensuite, les soldats ont craché sur lui. Car c’est ainsi que Covid-19 est transféré, à travers de petites gouttelettes d’aérosol expirées par la bouche. Les soldats lui ont délibérément craché dessus. Ce n’était pas une FUITE DE SALIVE ! Ils ont frappé Jésus sur la tête parce que les saints sont à la tête de l’église et ils ont attrapé Covid-19 non pas par une infection fortuite au hasard mais par un coup délibéré avec une lecture, une arme biologique, une attaque armée délibérée

Ainsi, ce que le professeur Montagnier a vu avec son expertise en virologie, je l’ai vu avec mon expertise en théologie. Cela montre que si les vérificateurs de faits et la science s’excluent mutuellement, la science et la théologie s’accordent en fait, lorsqu’elles sont bien comprises (et c’est là une grosse mise en garde). Le professeur M nous a appris que les vaccins causent les variants. En effet, la virologie de base interdit la vaccination de masse pendant une pandémie pour cette raison même. Il a dit que la courbe des décès suit la courbe des vaccinations. Remarquez, paradoxalement, si les vaccins ont causé Omicron, ils nous ont sauvés d’eux-mêmes !

Le temps est venu de demander des comptes aux personnes et aux organisations

Les fabricants de Covid-19, les fabricants de vaccins génétiques, leurs bailleurs de fonds et leurs promoteurs, qui comprennent presque tous les gouvernements, les secteurs publics et les services de santé du monde, sont donc coupables de génocide et de crimes contre l’humanité. Ils ont imposé le viol génétique, la maladie et la mort à la moitié de la population mondiale afin d’enrichir les poches des sociétés pharmaceutiques. Les gouvernements et les secteurs publics du monde entier ont abandonné la réglementation de leurs services de santé aux milliardaires et aux sociétés sans cœur.

Au Royaume-Uni, la totalité de l’impôt sur le revenu que nous payons va au service de santé et tous ses protocoles sont déterminés par ses régulateurs et tous ses régulateurs sont contrôlés et financés par Big Pharma qui cherche à endommager puis à gérer notre santé pour son profit.

Ainsi, chaque cent que nous dépensons en impôt sur le revenu nous rapproche un peu plus de la maladie, de la mort et de la toxicomanie.

Alors pourquoi le professeur Montagnier a-t-il choisi de passer les dernières années de sa vie à prouver que le Covid-19 était une création humaine et que les protéines de pointe, et donc les vaccins, étaient une menace existentielle pour l’espèce ? Que lui restait-il à prouver à lui-même ou à qui que ce soit d’autre à 87-89 ? Il ne l’a certainement pas fait pour accroître sa réputation dans la profession.

Non, il était animé par la même passion qui l’a poussée à découvrir le VIH. Une passion pour SAUVER l’humanité des virus et de ceux qui voudraient les désigner pour nous nuire. Et pourquoi at-il rendu l’âme en février 2022 ? Parce qu’il savait qu’Omicron avait battu les vaccins. Son travail a été fait par un plus grand virologue que lui. Il a donc pu se reposer en paix et aller voir des gens qui ont compris l’ampleur de sa contribution.

Covid-19 n’a pas été fabriqué en 2019. Il a été fabriqué à partir du site de clivage de la furine chimérique spécifique de Moderna (CGG pour AGA) à 19 nucléotides qui n’existent nulle part dans la nature. Et chaque décès de Covid et chaque décès par vaccin Covid est carrément garé à la porte de ModeRNA en attente de justice.

Mais nous n’exécuterons pas cette justice assez vite. Et donc le fléau final sur l’humanité d’Apocalypse 6: 8, livré par le 4ème cavalier de l’apocalypse, que Bill Gates lui-même a prophétisé, arrivera plus tard cette année (après la guerre et après la famine, les 2ème et 3ème cavaliers).

Fin de l’étude par un lecteur inquiet

Récente prise de position de Jeffrey Sachs qui préside la commission Covid-19 de la prestigieuse revue médicale The Lancet 
1ère partie

Jeffrey Sachs, économiste et auteur de renommée mondiale, a affirmé que le Covid-19 n’était pas issu de la nature, mais plutôt d’un rejet accidentel « de la biotechnologie des laboratoires américains ». Il s’exprimait lors d’une conférence organisée par le groupe de réflexion GATE Center, en Espagne, à la mi-juin.

« C’est donc une bévue, à mon avis, de la biotechnologie, et non un accident d’un débordement naturel », a-t-il réaffirmé.

L’universitaire a noté que même si « nous ne savons pas avec certitude » si c’est le cas, il y a « suffisamment de preuves » qui vont dans ce sens, ce qui « devrait être examiné ». Sachs a déploré que cette version ne soit cependant « pas étudiée, ni aux États-Unis, ni ailleurs ».

En mai dernier, Sachs et Neil Harrison, professeur de pharmacologie moléculaire et de thérapeutique à l’université Columbia, ont rédigé un article dans les Proceedings of the National Academy of Sciences, suggérant que le Covid-19 avait été créé en laboratoire. Dans cet article, les deux universitaires appellent à une plus grande transparence de la part des agences fédérales et des universités américaines, arguant que de nombreuses preuves pertinentes n’ont pas été divulguées.

Selon Sachs et Harrison, les bases de données virales, les échantillons biologiques, les séquences virales, les communications par courrier électronique et les cahiers de laboratoire pourraient tous contribuer à faire la lumière sur l’origine de la pandémie. Toutefois, aucun de ces documents n’a fait l’objet d’un « examen indépendant, transparent et scientifique », affirment-ils.

Comme indicateur que le Covid-19 provenait d’un laboratoire, les auteurs ont évoqué le fait qu’une séquence de huit acides aminés sur une partie critique de la protéine de pointe du virus est similaire à une séquence d’acides aminés trouvée dans les cellules qui tapissent les voies respiratoires humaines.

En fait, Sachs n’est pas le premier à suggérer que le virus mortel n’est pas apparu naturellement.

2ème partie

Un appel à une enquête indépendante sur l’origine du virus SARS-CoV-2

L’enquête sur l’origine du virus a été rendue difficile par le manque de preuves clés dès les premiers jours de l’épidémie – il ne fait aucun doute qu’une plus grande transparence de la part des autorités chinoises serait extrêmement utile. Néanmoins, nous soutenons ici qu’il existe de nombreuses informations importantes qui peuvent être glanées auprès d’institutions de recherche basées aux États-Unis, informations qui ne sont pas encore mises à disposition pour un examen indépendant, transparent et scientifique.

Lorsqu’il s’agit de déchiffrer les origines de la COVID-19, de nombreuses informations importantes peuvent être glanées auprès d’institutions de recherche basées aux États-Unis – des informations qui n’ont pas encore été mises à disposition pour un examen indépendant, transparent et scientifique

Enquêtes américaines essentielles

Cette absence d’une enquête scientifique indépendante et transparente basée aux États-Unis a eu quatre conséquences très néfastes. Premièrement, la confiance du public dans la capacité des institutions scientifiques américaines à gouverner les activités de la science américaine de manière responsable a été ébranlée. Deuxièmement, l’enquête sur l’origine du SARS-CoV-2 s’est politisée au sein du Congrès américain ; par conséquent, le lancement d’une enquête indépendante et transparente a été entravé et retardé. Troisièmement, les chercheurs américains ayant une connaissance approfondie des possibilités d’un incident associé à un laboratoire n’ont pas été en mesure de partager efficacement leur expertise. Quatrièmement, l’échec des NIH, l’un des principaux bailleurs de fonds du travail collaboratif entre les États-Unis et la Chine, à faciliter l’enquête sur les origines du SARS-CoV-2 a suscité la méfiance à l’égard des activités de recherche américaines sur la biodéfense.

Les dénégations générales des NIH ne sont plus suffisantes. Bien que le NIH et l’USAID aient vigoureusement résisté à la divulgation complète des détails du programme de travail EHA-WIV-UNC, plusieurs documents divulgués au public ou publiés par le biais de la Freedom of Information Act (FOIA) ont soulevé des préoccupations. Ces propositions de recherche indiquent clairement que la collaboration EHA-WIV-UNC a participé à la collecte d’un grand nombre de virus semblables au SRAS jusqu’à présent non documentés et s’est engagée dans leur manipulation dans les installations de laboratoire de niveau de sécurité biologique (BSL)-2 et BSL-3, ce qui soulève des préoccupations quant au fait qu’un virus en suspension dans l’air pourrait avoir infecté un travailleur de laboratoire. Divers scénarios ont été discutés par d’autres, y compris une infection impliquant un virus naturel recueilli sur le terrain ou peut-être un virus modifié manipulé dans l’un des laboratoires.

Détails négligés

Des préoccupations particulières entourent la présence d’un site de clivage de la furine (SCF) inhabituel dans le SRAS-CoV-2  qui augmente la pathogénicité et la transmissibilité du virus par rapport à des virus apparentés comme le SRAS-CoV-1.

Rechercher la transparence

Nous n’affirmons pas que la manipulation en laboratoire ait été impliquée dans l’émergence du SARS-CoV-2, bien qu’il soit évident que cela aurait pu l’être. Cependant, nous affirmons qu’il n’y a pas eu à ce jour d’examen scientifique indépendant et transparent de toute la portée des preuves américaines.

Les preuves pertinentes basées aux États-Unis comprendraient les informations suivantes : cahiers de laboratoire, bases de données sur les virus, médias électroniques (courriels, autres communications), échantillons biologiques, séquences virales recueillies et conservées dans le cadre du projet PREDICT et d’autres programmes financés, et entretiens de l’équipe de recherche dirigée par l’EHA par des chercheurs indépendants, ainsi qu’un dossier complet de la participation des agences américaines au financement de la recherche sur les virus de type SRAS, en particulier en ce qui concerne les projets en collaboration avec des institutions basées à Wuhan.

L’étude du Pr Montagnier

« Covid-19, SARS and bats coronaviruses genomes peculiar homologous RNA sequences »

Extraits :


1) 18 fragments d’ARN d’homologie égale ou supérieure à 80% avec des rétrovirus humains ou simiens ont été trouvé dans le génome du COVID-19.

2) Ces fragments ont une longueur de 18 à 30 nucléotides et ont donc le potentiel de modifier l’expression du gène Covid-19. Nous les avons nommés éléments informatifs externes ou EIE.

3) Ces EIE ne sont pas dispersés au hasard, mais sont concentrés dans une petite partie du génome de COVID-19.

4) Parmi cette partie, une région de 225 nucléotides de long est unique à COVID-19 et Bat RaTG13 et peut discriminer et distinguer formellement ces 2 génomes.

5) Dans la pente décroissante de l’épidémie, cette région de 225 bases et la région de 1770 bases de l’épi, présentent un taux anormalement élevé de mutations/délétions (cas de 44 patients de l’état de WA Seattle, l’épicentre initial aux États-Unis).

6) Dans l’analyse comparative des deux gènes SPIKES de COVID-19 et de Bat RaTG13, nous constatons deux faits anormaux : 1.

faits anormaux :

– L’insertion de 4 acides aminés ARRP contigus au milieu de SPIKE (nous montrons alors que ce site était déjà un site de clivage optimal AVANT cette insertion).

– Un ratio anormal de codons synonymes/codons non synonymes dans la seconde moitié de SPIKE.

Enfin nous montrons l’insertion dans cette région SPIKE de 1770 bases d’une EIE significative de Plasmodium Yoelii et d’une possible EIE du VIH1 avec une mutation cruciale de Spike.

À travers les 14 faits relatifs à chacun des 14 paragraphes de cet article, tout converge vers de possibles des manipulations de laboratoire (Note de fin ci-dessous) qui ont contribué à modifier le génome de COVID-19, mais aussi, très probablement d’un SARS beaucoup plus ancien, avec peut-être ce double objectif de conception d’un vaccin et de « gain de fonction » en termes de pénétration de ce virus dans l’organisme termes de pénétration de ce virus dans la cellule.

Cette analyse, réalisée in silico, est dédiée aux véritables auteurs du Coronavirus COVID-19. Il ne tient qu’à eux de décrire leurs propres expériences et pourquoi elles se sont transformées en un désastre mondial : 650 000 vies (le 26 juillet 2020), soit plus que celles prises par les deux bombes atomiques d’Hiroshima et de Nagasaki. Nous, les survivants, devrions tirer les leçons de cette grave alerte pour l’avenir de l’humanité. Nous demandons instamment à nos collègues scientifiques et médecins de respecter les règles éthiques telles qu’exprimées par le serment d’Hipocrate : ne pas nuire, jamais et jamais !

Note de fin : Pourquoi COVID-19 pourrait-il provenir de manipulations du Laboratoire ?

Les 4 preuves suivantes concernent des différences par rapport au SRAS soit communes à COVID-19 et à bat RaTG13, soit des faits différenciant radicalement ces 2 séquences dont on prétend que la première (COVID-19) provient d’une évolution naturelle de la seconde (bat RaTG13).

Nous avons classé ces 4 preuves par ordre croissant d’importance selon notre point de vue :

1) Quatre EIE distinguent formellement les génomes de COVID-19 et de bat RaTG13 de tous les autres génomes de SRAS ou de chauve-souris. Cependant, leur niveau d’homologies VIH/SIV semble beaucoup plus affirmé pour COVID-19 que pour la chauve-souris RaTG13, comme si ces fragments EIE avaient été récemment « réinjectés » dans le génome de COVID-19. ==> voir & 7, (figures 4 et 5).

2) les délétions naturelles (USA WA Seattle state) s’appliquent en priorité aux inserts EIE (HIV Kenya etc ..). ==> voir la partie III complète et la figure 12 au §13.

3) Mutations de codons synonymes dans la région de 1770 bases du Spike, qui simulent une évolution naturelle de la chauve-souris RaTG13 vers COVID-19 tout en maintenant l’optimalité obtenue en valeurs d’acides aminés, probablement à partir d’expériences de « gain de fonction » en Laboratoire (optimalité commune aux deux séquences d’ARN COVID-19 et chauve-souris RaTG13) ==> voir la Figure 10 dans & 11 et la Figure 11 dans §12.

4) Les acides aminés « PRRA » ont été insérés exactement à l’emplacement de l’épi déjà théoriquement optimal sur les deux séquences COVID-19 et RATG13 (dont il constitue la principale différence) ==> voir Figure 13 in & 1415.


Commentaires de l’auteur :

Cher Prof XXX,

Merci pour votre courriel. Si vous pouvez prouver que mon raisonnement est erroné, je serais heureux d’écrire une correction dans mon prochain article.

J’ai lu la seule référence citée dans Wikipedia concernant le codon CGG du MERS-CoV et cet article déclare explicitement et catégoriquement…

« Tous les coronavirus humains analysés dans cette étude n’ont pas du tout utilisé deux codons synonymes (CGC, CGG) pour l’arginine ainsi que CCG pour la proline et UGA pour le codon stop »16.

Mon argument est très simple.

Aucun virus dans la nature n’utilise le codon CGG pour l’arginine dans un site de clivage de la furine. Je l’ai vérifié dans la base de données blast. J’ai fait la recherche. Rien n’a été trouvé. 

Veuillez donc me montrer un virus naturel (de préférence un virus apparu avant l’apparition de Moderna) avec un site de clivage de la furine contenant deux codons CGG et vous vaincrez mon argument.

Je crains que vous ne vous soyez fait avoir XXX – pas par moi, mais par Wikipedia !


Je n’ai pas reçu de réponse du professeur. Mais bizarrement, Wikipedia a changé le numéro de référence de 107 à 116 dans l’article ci-dessus. Pourtant, il renvoie toujours au même article ? Ainsi, Wikipedia déduit faussement que les « scientifiques », par opposition à un journaliste isolé, contestent qu’il y ait une faible probabilité que le double CGG se produise dans la nature, en notant que le codon CGG est présent dans le MERS et en citant un article qui déclare explicitement qu’aucun des coronavirus humains analysés dans cet article n’utilise un double codon CGG. Wikipedia fournit de la désinformation qui se trouve justement à protéger les intérêts des compagnies pharmaceutiques.

Mais tout cela est – si j’ose dire – théorique. Parce qu’il n’y a absolument aucun virus qui possède un doublet CGG dans un site de clivage de la furine (PRRAR), à l’exception de Covid-19 et des virus végétaux que Dow Agroscience, Monsanto ou autres ont modifiés. Et que vous soyez journaliste ou biologiste cellulaire ou les deux (comme moi) ou aucun des deux, cet article vous donne les outils pour vérifier ce FAIT par vous-même17.

source : Les Moutons Enragés


Laisser un commentaire

Your email address will not be published.